Transcript: Human XM_011523419.3

PREDICTED: Homo sapiens CBFA2/RUNX1 partner transcriptional co-repressor 3 (CBFA2T3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBFA2T3 (863)
Length:
2400
CDS:
145..1821

Additional Resources:

NCBI RefSeq record:
XM_011523419.3
NBCI Gene record:
CBFA2T3 (863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523419.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020166 GCCCGACAGGACCAAAGAGAA pLKO.1 1029 CDS 100% 1.650 2.310 N CBFA2T3 n/a
2 TRCN0000020168 CCACTCACCAACAGCCATCAA pLKO.1 540 CDS 100% 4.950 3.465 N CBFA2T3 n/a
3 TRCN0000020167 CCCAGTGGACAGGAAAGCTAA pLKO.1 297 CDS 100% 4.950 3.465 N CBFA2T3 n/a
4 TRCN0000437851 AGTCAACGAGAACGGCAAGAG pLKO_005 1002 CDS 100% 4.050 2.835 N CBFA2T3 n/a
5 TRCN0000020164 CCTGAACTGCATCATGGACAT pLKO.1 1350 CDS 100% 4.050 2.835 N CBFA2T3 n/a
6 TRCN0000020165 GAGGAGTTTCATTCCAAGCTT pLKO.1 784 CDS 100% 3.000 2.100 N CBFA2T3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523419.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.