Transcript: Human XM_011523741.2

PREDICTED: Homo sapiens RAP1 GTPase activating protein 2 (RAP1GAP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAP1GAP2 (23108)
Length:
2943
CDS:
237..2372

Additional Resources:

NCBI RefSeq record:
XM_011523741.2
NBCI Gene record:
RAP1GAP2 (23108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165670 GTCGTCGGAGTTCTTTGAGAT pLKO.1 344 CDS 100% 4.950 6.930 N RAP1GAP2 n/a
2 TRCN0000165671 GAACTTGATCCTGTCCGTCAA pLKO.1 710 CDS 100% 4.050 5.670 N RAP1GAP2 n/a
3 TRCN0000161447 CGGGTCCTTTATCATCCTATT pLKO.1 2651 3UTR 100% 10.800 7.560 N RAP1GAP2 n/a
4 TRCN0000165180 GCAGTGGGACTGAGATTCAAT pLKO.1 870 CDS 100% 5.625 3.938 N RAP1GAP2 n/a
5 TRCN0000161211 GAAGCCCTTCATGAAGTTGAA pLKO.1 2042 CDS 100% 4.950 3.465 N RAP1GAP2 n/a
6 TRCN0000162070 CAAGGACGACTATATCCCATA pLKO.1 422 CDS 100% 4.050 2.835 N RAP1GAP2 n/a
7 TRCN0000165695 CCCTCAGATTGCAAAGGCTTT pLKO.1 839 CDS 100% 4.050 2.430 N RAP1GAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.