Transcript: Human XM_011523765.2

PREDICTED: Homo sapiens myosin phosphatase Rho interacting protein (MPRIP), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPRIP (23164)
Length:
15369
CDS:
299..7513

Additional Resources:

NCBI RefSeq record:
XM_011523765.2
NBCI Gene record:
MPRIP (23164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296941 ACGCAAGTGACAAGTACAAAG pLKO_005 7242 CDS 100% 10.800 15.120 N MPRIP n/a
2 TRCN0000048651 GCGACGGTTCTTCATCCTTTA pLKO.1 604 CDS 100% 10.800 15.120 N MPRIP n/a
3 TRCN0000048649 GCCGACTTGGATGGAGAAATT pLKO.1 2027 CDS 100% 13.200 9.240 N MPRIP n/a
4 TRCN0000291591 GCCGACTTGGATGGAGAAATT pLKO_005 2027 CDS 100% 13.200 9.240 N MPRIP n/a
5 TRCN0000048652 CCAGAAGTTCTCCCTGTGTAT pLKO.1 736 CDS 100% 4.950 3.465 N MPRIP n/a
6 TRCN0000307723 CCAGAAGTTCTCCCTGTGTAT pLKO_005 736 CDS 100% 4.950 3.465 N MPRIP n/a
7 TRCN0000091177 GCCTGAGATACTACAGGGATT pLKO.1 1989 CDS 100% 4.050 2.835 N Mprip n/a
8 TRCN0000318286 GCCTGAGATACTACAGGGATT pLKO_005 1989 CDS 100% 4.050 2.835 N Mprip n/a
9 TRCN0000048650 GCTCTTTGAATCCAGGGACTT pLKO.1 7582 3UTR 100% 4.050 2.835 N MPRIP n/a
10 TRCN0000307725 GCTCTTTGAATCCAGGGACTT pLKO_005 7582 3UTR 100% 4.050 2.835 N MPRIP n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 12167 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 12167 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523765.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.