Transcript: Human XM_011523855.2

PREDICTED: Homo sapiens LLGL scribble cell polarity complex component 1 (LLGL1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LLGL1 (3996)
Length:
4248
CDS:
91..3279

Additional Resources:

NCBI RefSeq record:
XM_011523855.2
NBCI Gene record:
LLGL1 (3996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523855.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117140 TGGGAGATTGTCCACCATAAT pLKO.1 394 CDS 100% 13.200 10.560 N LLGL1 n/a
2 TRCN0000117138 GCCTATACTTTGCCGACACAT pLKO.1 2264 CDS 100% 4.950 3.960 N LLGL1 n/a
3 TRCN0000117139 CCCATCAGAATTTGAACGCTT pLKO.1 2874 CDS 100% 2.640 2.112 N LLGL1 n/a
4 TRCN0000117141 CCACAAAGATTCTCATTGGCT pLKO.1 713 CDS 100% 0.750 0.600 N LLGL1 n/a
5 TRCN0000117137 CCCTCACTTTGCAGAGTATTT pLKO.1 3590 3UTR 100% 13.200 9.240 N LLGL1 n/a
6 TRCN0000421180 GGTTGCTCTCTGCAAGTATAC pLKO_005 1647 CDS 100% 10.800 7.560 N LLGL1 n/a
7 TRCN0000428443 GACTTCACTTCCCGCATCATC pLKO_005 1093 CDS 100% 4.950 3.465 N LLGL1 n/a
8 TRCN0000427281 GCAAGGCCATTAACAAGATTC pLKO_005 953 CDS 100% 10.800 6.480 N LLGL1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3873 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3739 3UTR 100% 2.640 1.320 Y LINC01098 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3873 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523855.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.