Transcript: Human XM_011523868.2

PREDICTED: Homo sapiens MAX network transcriptional repressor (MNT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MNT (4335)
Length:
4766
CDS:
166..1938

Additional Resources:

NCBI RefSeq record:
XM_011523868.2
NBCI Gene record:
MNT (4335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234789 TTACCGTAGATACTACTTAAA pLKO_005 2564 3UTR 100% 13.200 18.480 N MNT n/a
2 TRCN0000234788 GGACAACATAGACGAGGATAT pLKO_005 1197 CDS 100% 10.800 15.120 N MNT n/a
3 TRCN0000020397 CCCGGCTACTGTCATGGCAAA pLKO.1 1800 CDS 100% 1.350 1.890 N MNT n/a
4 TRCN0000234786 CACCAGCTGAAGAAGTCAAAT pLKO_005 794 CDS 100% 13.200 9.240 N MNT n/a
5 TRCN0000234785 GGAACAGAAGAAGGCCAATAG pLKO_005 303 CDS 100% 10.800 7.560 N MNT n/a
6 TRCN0000234787 ATGACAAGAAGACGTCCAATC pLKO_005 941 CDS 100% 6.000 4.200 N MNT n/a
7 TRCN0000020395 CCACAACAAATTGGAGAAGAA pLKO.1 861 CDS 100% 4.950 3.465 N MNT n/a
8 TRCN0000085733 CCGAATGACTATGTCCAGATT pLKO.1 4011 3UTR 100% 4.950 3.465 N Mnt n/a
9 TRCN0000020396 GCACCAGCTGAAGAAGTCAAA pLKO.1 793 CDS 100% 4.950 3.465 N MNT n/a
10 TRCN0000020398 GAGGACAACATAGACGAGGAT pLKO.1 1195 CDS 100% 2.640 1.848 N MNT n/a
11 TRCN0000020394 CCTGCAAATCTAGTGCCGAAA pLKO.1 3996 3UTR 100% 4.050 5.670 N MNT n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4213 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523868.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.