Transcript: Human XM_011523928.2

PREDICTED: Homo sapiens ankyrin repeat and FYVE domain containing 1 (ANKFY1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKFY1 (51479)
Length:
7595
CDS:
163..3636

Additional Resources:

NCBI RefSeq record:
XM_011523928.2
NBCI Gene record:
ANKFY1 (51479)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414618 CAATGCTTCGCTGGATCTATA pLKO_005 470 CDS 100% 13.200 18.480 N ANKFY1 n/a
2 TRCN0000443407 CACGACGACTGGAGAGTATTG pLKO_005 917 CDS 100% 10.800 15.120 N ANKFY1 n/a
3 TRCN0000059044 CCCGCTACATAAAGCCATCAA pLKO.1 783 CDS 100% 4.950 6.930 N ANKFY1 n/a
4 TRCN0000059047 GCAGTGCAAACAACTAGATTT pLKO.1 1284 CDS 100% 13.200 10.560 N ANKFY1 n/a
5 TRCN0000059043 CCGTGGTAAATGGGACTTCAT pLKO.1 1403 CDS 100% 4.950 3.960 N ANKFY1 n/a
6 TRCN0000417560 TACAGCGATCTGAAGATAAAG pLKO_005 322 CDS 100% 13.200 9.240 N ANKFY1 n/a
7 TRCN0000416855 CATAACGGAGATCTGGCATTA pLKO_005 883 CDS 100% 10.800 7.560 N ANKFY1 n/a
8 TRCN0000427663 GTGTTATGTCTCTAGTGAATG pLKO_005 593 CDS 100% 10.800 7.560 N ANKFY1 n/a
9 TRCN0000437001 TGTCTGAGATGGCGCAGATTG pLKO_005 1151 CDS 100% 10.800 7.560 N ANKFY1 n/a
10 TRCN0000436370 TTGGACCTGTCAGATGCTAAT pLKO_005 433 CDS 100% 10.800 7.560 N ANKFY1 n/a
11 TRCN0000059046 GCCATCAAAGTGGAGAGAGAA pLKO.1 796 CDS 100% 4.950 3.465 N ANKFY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523928.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.