Transcript: Human XM_011524202.1

PREDICTED: Homo sapiens G protein subunit alpha 13 (GNA13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNA13 (10672)
Length:
1423
CDS:
4..615

Additional Resources:

NCBI RefSeq record:
XM_011524202.1
NBCI Gene record:
GNA13 (10672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036885 GCTCGAGAGAAGCTTCATATT pLKO.1 307 CDS 100% 0.000 0.000 N GNA13 n/a
2 TRCN0000435189 TCTACAGCAACGTGATCAAAG pLKO_005 266 CDS 100% 10.800 7.560 N GNA13 n/a
3 TRCN0000036887 GATAAGATGATGTCGTTTGAT pLKO.1 361 CDS 100% 5.625 3.938 N GNA13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02502 pDONR223 100% 50.7% 50.1% None (many diffs) n/a
2 ccsbBroad304_02502 pLX_304 59.8% 50.7% 50.1% V5 (many diffs) n/a
Download CSV