Transcript: Human XM_011524289.1

PREDICTED: Homo sapiens solute carrier family 38 member 10 (SLC38A10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A10 (124565)
Length:
4449
CDS:
513..3893

Additional Resources:

NCBI RefSeq record:
XM_011524289.1
NBCI Gene record:
SLC38A10 (124565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155811 CCTCTCCGGTTTAAAGCACTT pLKO.1 1485 CDS 100% 4.050 5.670 N SLC38A10 n/a
2 TRCN0000156089 CGTGTTCATGTTCGTGATCGT pLKO.1 1019 CDS 100% 2.640 3.696 N SLC38A10 n/a
3 TRCN0000353700 CGTGTTCATGTTCGTGATCGT pLKO_005 1019 CDS 100% 2.640 3.696 N SLC38A10 n/a
4 TRCN0000151835 CATATTTGCTTCCTCCCTTAA pLKO.1 1217 CDS 100% 10.800 7.560 N SLC38A10 n/a
5 TRCN0000330909 CATATTTGCTTCCTCCCTTAA pLKO_005 1217 CDS 100% 10.800 7.560 N SLC38A10 n/a
6 TRCN0000330843 CATGGTTGGTGGCATCCTTAT pLKO_005 1529 CDS 100% 10.800 7.560 N SLC38A10 n/a
7 TRCN0000330911 ATCGCCTTCTACGTCGTGATC pLKO_005 825 CDS 100% 4.050 2.835 N SLC38A10 n/a
8 TRCN0000154868 GAGAACAAACCTCCATCCAGA pLKO.1 2088 CDS 100% 2.640 1.848 N SLC38A10 n/a
9 TRCN0000156088 CCAGAAGAGAACAAACCTCCA pLKO.1 2082 CDS 100% 2.160 1.512 N SLC38A10 n/a
10 TRCN0000155211 GCTGATCACGAACATCGTGAA pLKO.1 542 CDS 100% 0.405 0.284 N SLC38A10 n/a
11 TRCN0000154589 GAGGTGCCAGAAGAGAACAAA pLKO.1 2076 CDS 100% 5.625 3.375 N SLC38A10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524289.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.