Transcript: Human XM_011524632.3

PREDICTED: Homo sapiens KAT8 regulatory NSL complex subunit 1 (KANSL1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KANSL1 (284058)
Length:
3748
CDS:
101..2188

Additional Resources:

NCBI RefSeq record:
XM_011524632.3
NBCI Gene record:
KANSL1 (284058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524632.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364847 ACACCATGCCTCCCGAAATTC pLKO_005 795 CDS 100% 13.200 18.480 N KANSL1 n/a
2 TRCN0000369822 CTCGTAAGGACAGGCACAAAT pLKO_005 1026 CDS 100% 13.200 18.480 N KANSL1 n/a
3 TRCN0000376443 ACTCACTAACTATTGGCATTA pLKO_005 2212 3UTR 100% 10.800 15.120 N KANSL1 n/a
4 TRCN0000241470 CAAACAGATACGTGCTAATAA pLKO_005 280 CDS 100% 15.000 10.500 N Kansl1 n/a
5 TRCN0000369878 CAAACAGATACGTGCTAATAA pLKO_005 280 CDS 100% 15.000 10.500 N KANSL1 n/a
6 TRCN0000369821 GTTCATCCTGTTCTAGCATTT pLKO_005 863 CDS 100% 10.800 7.560 N KANSL1 n/a
7 TRCN0000141459 CTCGCGTAGAGAAACTGCAAT pLKO.1 1494 CDS 100% 4.950 3.465 N KANSL1 n/a
8 TRCN0000122200 GAACAGGCATTTGATTCAGAT pLKO.1 4 5UTR 100% 4.950 3.465 N KANSL1 n/a
9 TRCN0000143210 GAGACCATTCATCTGAGAGAA pLKO.1 1236 CDS 100% 4.950 3.465 N KANSL1 n/a
10 TRCN0000144514 CTGCAATACAAGGAAATCCTT pLKO.1 1508 CDS 100% 3.000 2.100 N KANSL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524632.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.