Transcript: Human XM_011524980.1

PREDICTED: Homo sapiens NPL4 homolog, ubiquitin recognition factor (NPLOC4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPLOC4 (55666)
Length:
4492
CDS:
219..2069

Additional Resources:

NCBI RefSeq record:
XM_011524980.1
NBCI Gene record:
NPLOC4 (55666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338872 CGGAAGGTTGGCTGGATATTT pLKO_005 1134 CDS 100% 15.000 21.000 N NPLOC4 n/a
2 TRCN0000338873 CGTCCGCTACAGTCGAAATAA pLKO_005 1190 CDS 100% 15.000 21.000 N NPLOC4 n/a
3 TRCN0000350998 ATTCGATGAGGACTATCTAAA pLKO_005 656 CDS 100% 13.200 18.480 N NPLOC4 n/a
4 TRCN0000153383 GCATTGGCGATTTGTCTGATT pLKO.1 4021 3UTR 100% 4.950 6.930 N NPLOC4 n/a
5 TRCN0000152140 CCTATTTGTCTCAGAATACCT pLKO.1 1702 CDS 100% 3.000 2.400 N NPLOC4 n/a
6 TRCN0000338874 CCACCCAGCCTTCTCTTTATT pLKO_005 2467 3UTR 100% 15.000 10.500 N NPLOC4 n/a
7 TRCN0000153073 GCTGAAGTGGTCGATGAAATT pLKO.1 1095 CDS 100% 13.200 9.240 N NPLOC4 n/a
8 TRCN0000152941 GACAACCAAGTCCACTTTGAA pLKO.1 1362 CDS 100% 5.625 3.938 N NPLOC4 n/a
9 TRCN0000150649 GCACTATGAACAGAGAACATT pLKO.1 3450 3UTR 100% 5.625 3.938 N NPLOC4 n/a
10 TRCN0000158228 CCTGACAACCAAGTCCACTTT pLKO.1 1359 CDS 100% 4.950 3.465 N NPLOC4 n/a
11 TRCN0000338871 CCTGACAACCAAGTCCACTTT pLKO_005 1359 CDS 100% 4.950 3.465 N NPLOC4 n/a
12 TRCN0000152847 GCGATTTGTCTGATTCTGGTT pLKO.1 4027 3UTR 100% 2.640 1.848 N NPLOC4 n/a
13 TRCN0000215673 GAACATCAGCTGCAAGATTAA pLKO.1 770 CDS 100% 13.200 7.920 N Nploc4 n/a
14 TRCN0000153539 CCACATTCTTGGCACTATGAA pLKO.1 3439 3UTR 100% 5.625 3.375 N NPLOC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524980.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.