Transcript: Human XM_011525399.2

PREDICTED: Homo sapiens chromobox 4 (CBX4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CBX4 (8535)
Length:
4158
CDS:
1871..3355

Additional Resources:

NCBI RefSeq record:
XM_011525399.2
NBCI Gene record:
CBX4 (8535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234581 GCCTCAGAGTTCTAGTATTAT pLKO_005 3639 3UTR 100% 15.000 21.000 N CBX4 n/a
2 TRCN0000234579 CGTGATCGTGATGAGCAAATA pLKO_005 2458 CDS 100% 13.200 18.480 N CBX4 n/a
3 TRCN0000010847 TGCCTACCTTTGCCCGTCGTT pLKO.1 1920 CDS 100% 0.880 0.704 N CBX4 n/a
4 TRCN0000234580 GCCCTTCTTTGGGAATATAAT pLKO_005 3274 CDS 100% 15.000 10.500 N CBX4 n/a
5 TRCN0000235606 GCCCTTCTTTGGGAATATAAT pLKO_005 3274 CDS 100% 15.000 10.500 N Cbx4 n/a
6 TRCN0000077376 CCTGGATGAACCCATAGACTT pLKO.1 3076 CDS 100% 4.950 3.465 N Cbx4 n/a
7 TRCN0000004077 CAAGAACAAGAACGGACGCAT pLKO.1 2437 CDS 100% 2.640 1.848 N CBX4 n/a
8 TRCN0000004075 TCCAGGCAAAGGCTCCGAGAA pLKO.1 2332 CDS 100% 1.350 0.945 N CBX4 n/a
9 TRCN0000004076 GCAAATACATGGAGAACGGCA pLKO.1 2472 CDS 100% 0.660 0.462 N CBX4 n/a
10 TRCN0000235609 ACCAGTAACCTTGGTATATAT pLKO_005 3959 3UTR 100% 15.000 9.000 N Cbx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13997 pDONR223 98.8% 39.9% 39.8% None 0_1ins198;181_990del;1473C>N n/a
2 ccsbBroad304_13997 pLX_304 0% 39.9% 39.8% V5 0_1ins198;181_990del;1473C>N n/a
Download CSV