Transcript: Human XM_011525490.2

PREDICTED: Homo sapiens T-box transcription factor 4 (TBX4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBX4 (9496)
Length:
3436
CDS:
13..1842

Additional Resources:

NCBI RefSeq record:
XM_011525490.2
NBCI Gene record:
TBX4 (9496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013450 GCCCACTTTAGTGTCTACAAT pLKO.1 1609 CDS 100% 5.625 7.875 N TBX4 n/a
2 TRCN0000428244 TGCCGATGACCATCGCTACAA pLKO_005 564 CDS 100% 4.950 6.930 N TBX4 n/a
3 TRCN0000013449 CCGAGAATCTTCCTTACAGTA pLKO.1 1779 CDS 100% 4.950 3.960 N TBX4 n/a
4 TRCN0000415957 AGGACCTGGGTCTATTGTTAT pLKO_005 2087 3UTR 100% 13.200 9.240 N TBX4 n/a
5 TRCN0000432100 GACCGTGTTGCTCCAGTATTA pLKO_005 1869 3UTR 100% 13.200 9.240 N TBX4 n/a
6 TRCN0000422840 AGCATCCATCTTCTGACATAC pLKO_005 2006 3UTR 100% 10.800 7.560 N TBX4 n/a
7 TRCN0000084572 TCGCTACAAGTTCTGTGACAA pLKO.1 576 CDS 100% 4.950 3.465 N Tbx4 n/a
8 TRCN0000013452 CCACATCTAAATGCTGCCAAT pLKO.1 1726 CDS 100% 4.050 2.835 N TBX4 n/a
9 TRCN0000013448 GCCACAATGTGTACTTTGATA pLKO.1 2411 3UTR 100% 5.625 3.375 N TBX4 n/a
10 TRCN0000013451 GCAGACCATCGAGAACATCAA pLKO.1 384 CDS 100% 4.950 2.970 N TBX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525490.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07430 pDONR223 100% 89.3% 89.1% None (many diffs) n/a
2 ccsbBroad304_07430 pLX_304 0% 89.3% 89.1% V5 (many diffs) n/a
Download CSV