Transcript: Human XM_011525553.3

PREDICTED: Homo sapiens mediator complex subunit 13 (MED13), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MED13 (9969)
Length:
9157
CDS:
145..6000

Additional Resources:

NCBI RefSeq record:
XM_011525553.3
NBCI Gene record:
MED13 (9969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234903 TCATGAGGAAGTACCTAATAT pLKO_005 5628 CDS 100% 15.000 21.000 N MED13 n/a
2 TRCN0000019916 CCGAACTAATGATGTAGCAAA pLKO.1 1008 CDS 100% 4.950 6.930 N MED13 n/a
3 TRCN0000019914 CGGTGTTTAATGAACAGGAAT pLKO.1 6 5UTR 100% 4.950 6.930 N MED13 n/a
4 TRCN0000234901 ACAAGATCAGTGCACTAATTT pLKO_005 3051 CDS 100% 15.000 10.500 N MED13 n/a
5 TRCN0000234904 GTTTAGGGCTATGACTAATAT pLKO_005 6912 3UTR 100% 15.000 10.500 N MED13 n/a
6 TRCN0000234902 AGCACGATGGATCGGGATAAA pLKO_005 4318 CDS 100% 13.200 9.240 N MED13 n/a
7 TRCN0000234900 GAACTAACACCTGGATCTAAA pLKO_005 1852 CDS 100% 13.200 9.240 N MED13 n/a
8 TRCN0000019917 CCAACTTGAATAGTGGAGTAT pLKO.1 4106 CDS 100% 4.950 3.465 N MED13 n/a
9 TRCN0000019915 CGACTCTAAATATGCAGACAT pLKO.1 5294 CDS 100% 4.950 3.465 N MED13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.