Transcript: Human XM_011525724.3

PREDICTED: Homo sapiens piezo type mechanosensitive ion channel component 2 (PIEZO2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIEZO2 (63895)
Length:
10621
CDS:
998..9331

Additional Resources:

NCBI RefSeq record:
XM_011525724.3
NBCI Gene record:
PIEZO2 (63895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525724.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167725 GTCTCCGTATTCCAATTTATT pLKO.1 2465 CDS 100% 15.000 21.000 N PIEZO2 n/a
2 TRCN0000123249 GCATTTCTAGTTCGACGGAAA pLKO.1 9408 3UTR 100% 4.050 5.670 N PIEZO2 n/a
3 TRCN0000121963 CCAGAGACAATACAACTAAAT pLKO.1 8928 CDS 100% 13.200 9.240 N PIEZO2 n/a
4 TRCN0000123251 CCTCACCAAGAGCTACAATTA pLKO.1 8038 CDS 100% 13.200 9.240 N PIEZO2 n/a
5 TRCN0000123252 GCTATGGTATTATGGGATTAT pLKO.1 9072 CDS 100% 13.200 9.240 N PIEZO2 n/a
6 TRCN0000167656 GTTTGGTATCAAGTCAGTAAT pLKO.1 1918 CDS 100% 13.200 9.240 N PIEZO2 n/a
7 TRCN0000123253 GCCCAACAAAGCCAGTTGAAA pLKO.1 8438 CDS 100% 5.625 3.938 N PIEZO2 n/a
8 TRCN0000172627 GCTGGTGATGTACTACACTCT pLKO.1 2020 CDS 100% 2.640 1.848 N PIEZO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525724.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.