Transcript: Human XM_011525774.2

PREDICTED: Homo sapiens THO complex 1 (THOC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THOC1 (9984)
Length:
2712
CDS:
1533..2606

Additional Resources:

NCBI RefSeq record:
XM_011525774.2
NBCI Gene record:
THOC1 (9984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272561 CAAAGATGGTAGAGCATATAT pLKO_005 1735 CDS 100% 15.000 10.500 N THOC1 n/a
2 TRCN0000000033 AGATACCAAACCTACGAGAAT pLKO.1 1847 CDS 100% 4.950 3.465 N THOC1 n/a
3 TRCN0000000029 TGATAAGAGGTCCACTGGTTT pLKO.1 2664 3UTR 100% 4.950 3.465 N THOC1 n/a
4 TRCN0000272617 TGATAAGAGGTCCACTGGTTT pLKO_005 2664 3UTR 100% 4.950 3.465 N THOC1 n/a
5 TRCN0000000031 AGACTCAGAAATTAGGCAGAT pLKO.1 2417 CDS 100% 4.050 2.835 N THOC1 n/a
6 TRCN0000272558 AGACTCAGAAATTAGGCAGAT pLKO_005 2417 CDS 100% 4.050 2.835 N THOC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525774.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07525 pDONR223 100% 52.7% 52.7% None 0_1ins921;286_306del n/a
2 ccsbBroad304_07525 pLX_304 0% 52.7% 52.7% V5 0_1ins921;286_306del n/a
3 TRCN0000470869 TTTATGCTAAAACAACGGGCGGCC pLX_317 10.6% 52.7% 52.7% V5 0_1ins921;286_306del n/a
Download CSV