Transcript: Human XM_011525788.1

PREDICTED: Homo sapiens cadherin 2 (CDH2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDH2 (1000)
Length:
3997
CDS:
345..2810

Additional Resources:

NCBI RefSeq record:
XM_011525788.1
NBCI Gene record:
CDH2 (1000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312701 GTGCAACAGTATACGTTAATA pLKO_005 1113 CDS 100% 15.000 21.000 N CDH2 n/a
2 TRCN0000053980 CCTAAGATCATTCGCCAAGAA pLKO.1 1590 CDS 100% 4.950 6.930 N CDH2 n/a
3 TRCN0000053981 CGCATTATGCAAGACTGGATT pLKO.1 176 5UTR 100% 4.950 3.960 N CDH2 n/a
4 TRCN0000327706 CGCATTATGCAAGACTGGATT pLKO_005 176 5UTR 100% 4.950 3.960 N CDH2 n/a
5 TRCN0000370054 GGAACGCTGCAGATCTATTTA pLKO_005 1854 CDS 100% 15.000 10.500 N CDH2 n/a
6 TRCN0000053978 CCAGTGACTATTAAGAGAAAT pLKO.1 2022 CDS 100% 13.200 9.240 N CDH2 n/a
7 TRCN0000327707 CCAGTGACTATTAAGAGAAAT pLKO_005 2022 CDS 100% 13.200 9.240 N CDH2 n/a
8 TRCN0000094854 GCTGTAGTTAGAATACTCAAT pLKO.1 3673 3UTR 100% 4.950 3.465 N Cdh2 n/a
9 TRCN0000053979 CCTCCAATCAACTTGCCAGAA pLKO.1 579 CDS 100% 4.050 2.835 N CDH2 n/a
10 TRCN0000053982 CCACCATATGACTCCCTGTTA pLKO.1 2637 CDS 100% 0.000 0.000 N CDH2 n/a
11 TRCN0000363633 CCACCATATGACTCCCTGTTA pLKO_005 2637 CDS 100% 0.000 0.000 N CDH2 n/a
12 TRCN0000349742 GCATTCAGAAGCTAGGCTTTA pLKO_005 2872 3UTR 100% 10.800 6.480 N CDH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.