Transcript: Human XM_011526246.1

PREDICTED: Homo sapiens serpin family B member 12 (SERPINB12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERPINB12 (89777)
Length:
3825
CDS:
209..1507

Additional Resources:

NCBI RefSeq record:
XM_011526246.1
NBCI Gene record:
SERPINB12 (89777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416384 CGATCTTGGGTGGAGTTTAAT pLKO_005 1406 CDS 100% 15.000 21.000 N SERPINB12 n/a
2 TRCN0000052308 CGACGATTGAAAGTGTTGATT pLKO.1 708 CDS 100% 5.625 7.875 N SERPINB12 n/a
3 TRCN0000052311 CCTTTCTGTCTAAATGCGAAT pLKO.1 917 CDS 100% 4.050 5.670 N SERPINB12 n/a
4 TRCN0000052312 GCCATCTCACTCTAAAGATAA pLKO.1 1063 CDS 100% 13.200 10.560 N SERPINB12 n/a
5 TRCN0000414277 AGGCAAAGATGATCGTCATAA pLKO_005 286 CDS 100% 13.200 9.240 N SERPINB12 n/a
6 TRCN0000427853 GTATTGCCAACAGGCTTTATG pLKO_005 627 CDS 100% 13.200 9.240 N SERPINB12 n/a
7 TRCN0000052310 GCACATCAGATTGATGAGGTA pLKO.1 380 CDS 100% 2.640 1.848 N SERPINB12 n/a
8 TRCN0000052309 GCTGTTTACTTCAAGGCCAAA pLKO.1 857 CDS 100% 4.050 2.430 N SERPINB12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14330 pDONR223 100% 98.3% 22.4% None 1_21del;295_296insN n/a
2 ccsbBroad304_14330 pLX_304 0% 98.3% 22.4% V5 (not translated due to prior stop codon) 1_21del;295_296insN n/a
Download CSV