Transcript: Human XM_011526867.1

PREDICTED: Homo sapiens glutamate ionotropic receptor kainate type subunit 5 (GRIK5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIK5 (2901)
Length:
5283
CDS:
1879..4620

Additional Resources:

NCBI RefSeq record:
XM_011526867.1
NBCI Gene record:
GRIK5 (2901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063329 CGAGTGGAAGTAGACATCTTT pLKO.1 1633 5UTR 100% 5.625 7.875 N GRIK5 n/a
2 TRCN0000063330 GATCAGACCAACATCGAGTAT pLKO.1 3652 CDS 100% 4.950 6.930 N GRIK5 n/a
3 TRCN0000437234 GCGCATGGTAGAGTATGATGG pLKO_005 2724 CDS 100% 4.050 5.670 N GRIK5 n/a
4 TRCN0000063332 GTGGCGGTCATGGAATTCATA pLKO.1 4135 CDS 100% 0.000 0.000 N GRIK5 n/a
5 TRCN0000438409 GAGGAGGACCATCGAGCTAAA pLKO_005 4045 CDS 100% 10.800 8.640 N GRIK5 n/a
6 TRCN0000423242 GTTTGGGCATGGAGAACATTG pLKO_005 4067 CDS 100% 10.800 8.640 N GRIK5 n/a
7 TRCN0000063328 CGAGTCCACCATGAACGAATA pLKO.1 3837 CDS 100% 10.800 7.560 N GRIK5 n/a
8 TRCN0000063331 GAGCCATATCTGTGGAGAGAA pLKO.1 1992 CDS 100% 4.950 3.465 N GRIK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.