Transcript: Human XM_011527119.1

PREDICTED: Homo sapiens solute carrier family 7 member 10 (SLC7A10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC7A10 (56301)
Length:
2229
CDS:
20..2002

Additional Resources:

NCBI RefSeq record:
XM_011527119.1
NBCI Gene record:
SLC7A10 (56301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436989 CAACCTTCGGAGGGATCAATG pLKO_005 1078 CDS 100% 10.800 15.120 N SLC7A10 n/a
2 TRCN0000437983 CGGCGTCATCATCATCCTTAC pLKO_005 1783 CDS 100% 6.000 4.200 N SLC7A10 n/a
3 TRCN0000043234 CACCATCATCATCGGGAACAT pLKO.1 157 CDS 100% 4.950 3.465 N SLC7A10 n/a
4 TRCN0000043236 CGTGTACACGTTCACCAACAT pLKO.1 853 CDS 100% 4.950 3.465 N SLC7A10 n/a
5 TRCN0000043233 CAGCTTCATCTCAGAGCCTAT pLKO.1 1750 CDS 100% 4.050 2.835 N SLC7A10 n/a
6 TRCN0000043237 CAATGCCTTTGCTTTCTGGAT pLKO.1 679 CDS 100% 2.640 1.848 N SLC7A10 n/a
7 TRCN0000043235 GCTCATCAACTATGTGTCCTT pLKO.1 1588 CDS 100% 2.640 1.848 N SLC7A10 n/a
8 TRCN0000219416 AGATCTTCCAAGGACACTTTG pLKO.1 642 CDS 100% 10.800 7.560 N Slc7a10 n/a
9 TRCN0000219410 CCATGACCTTCTCCAACTATG pLKO.1 435 CDS 100% 10.800 7.560 N Slc7a10 n/a
10 TRCN0000219413 TCATCATCGGGAACATCATTG pLKO.1 162 CDS 100% 10.800 7.560 N Slc7a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03719 pDONR223 100% 79.2% 75.7% None 912_996del;1100_1425del n/a
2 ccsbBroad304_03719 pLX_304 0% 79.2% 75.7% V5 912_996del;1100_1425del n/a
Download CSV