Transcript: Human XM_011527555.2

PREDICTED: Homo sapiens zinc finger protein 536 (ZNF536), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF536 (9745)
Length:
8477
CDS:
1714..5940

Additional Resources:

NCBI RefSeq record:
XM_011527555.2
NBCI Gene record:
ZNF536 (9745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279689 CGGACATCCCATCACCTTAAG pLKO_005 3994 CDS 100% 10.800 15.120 N ZNF536 n/a
2 TRCN0000157914 CCACGAAGACACTTTGGCAAA pLKO.1 3354 CDS 100% 4.050 5.670 N ZNF536 n/a
3 TRCN0000279627 CCACGAAGACACTTTGGCAAA pLKO_005 3354 CDS 100% 4.050 5.670 N ZNF536 n/a
4 TRCN0000158305 CGAACCGGAAATGATGACCAA pLKO.1 5355 CDS 100% 2.640 3.696 N ZNF536 n/a
5 TRCN0000153899 CGAAACGCAAAGATAACACCA pLKO.1 4883 CDS 100% 2.640 2.112 N ZNF536 n/a
6 TRCN0000279628 CGAAACGCAAAGATAACACCA pLKO_005 4883 CDS 100% 2.640 2.112 N ZNF536 n/a
7 TRCN0000370942 CACGCAGTCAGCATCCTTAAA pLKO_005 4164 CDS 100% 13.200 9.240 N ZNF536 n/a
8 TRCN0000151027 GATTTGGTTCACAGCACTAAA pLKO.1 3454 CDS 100% 13.200 9.240 N ZNF536 n/a
9 TRCN0000312433 GATTTGGTTCACAGCACTAAA pLKO_005 3454 CDS 100% 13.200 9.240 N ZNF536 n/a
10 TRCN0000173329 GAGATCGGAAGAGCTTATCAA pLKO.1 4495 CDS 100% 5.625 3.938 N Zfp536 n/a
11 TRCN0000156512 GCTGATTTGGTTCACAGCACT pLKO.1 3451 CDS 100% 2.640 1.848 N ZNF536 n/a
12 TRCN0000157119 GATGTTGAAACCGAACCGGAA pLKO.1 5344 CDS 100% 2.160 1.512 N ZNF536 n/a
13 TRCN0000279626 GATGTTGAAACCGAACCGGAA pLKO_005 5344 CDS 100% 2.160 1.512 N ZNF536 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.