Transcript: Human XM_011527638.2

PREDICTED: Homo sapiens coactivator associated arginine methyltransferase 1 (CARM1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CARM1 (10498)
Length:
3030
CDS:
366..1709

Additional Resources:

NCBI RefSeq record:
XM_011527638.2
NBCI Gene record:
CARM1 (10498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381340 TGCTTTCATCGGCTCCATAAT pLKO_005 1061 CDS 100% 13.200 18.480 N CARM1 n/a
2 TRCN0000007169 CTATGACTTGAGCAGTGTTAT pLKO.1 1433 CDS 100% 13.200 9.240 N CARM1 n/a
3 TRCN0000280242 CTATGACTTGAGCAGTGTTAT pLKO_005 1433 CDS 100% 13.200 9.240 N CARM1 n/a
4 TRCN0000007166 CTATGGGAACTGGGACACTTT pLKO.1 1831 3UTR 100% 4.950 3.465 N CARM1 n/a
5 TRCN0000280243 CTATGGGAACTGGGACACTTT pLKO_005 1831 3UTR 100% 4.950 3.465 N CARM1 n/a
6 TRCN0000007168 GCAGAACATGATGCAGGACTA pLKO.1 359 5UTR 100% 4.050 2.835 N CARM1 n/a
7 TRCN0000280244 GCAGAACATGATGCAGGACTA pLKO_005 359 5UTR 100% 4.050 2.835 N CARM1 n/a
8 TRCN0000039118 CCCGACCAACACCATGCACTA pLKO.1 1679 CDS 100% 1.350 0.945 N Carm1 n/a
9 TRCN0000011071 GCCACAACAACCTGATTCCTT pLKO.1 1474 CDS 100% 3.000 1.800 N CARM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.