Transcript: Human XM_011527780.2

PREDICTED: Homo sapiens zinc finger protein 627 (ZNF627), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF627 (199692)
Length:
2728
CDS:
193..1482

Additional Resources:

NCBI RefSeq record:
XM_011527780.2
NBCI Gene record:
ZNF627 (199692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229741 GAATTGGCATACGGTCTAATT pLKO_005 2101 3UTR 100% 13.200 18.480 N ZNF627 n/a
2 TRCN0000229739 TGTGGACGAGCCTTGAGTTAT pLKO_005 526 CDS 100% 13.200 18.480 N ZNF627 n/a
3 TRCN0000016719 CGATCCACTTACTTTCGAGTA pLKO.1 1384 CDS 100% 4.050 5.670 N ZNF627 n/a
4 TRCN0000218990 TGGGTCCTTCATCACTTAATA pLKO_005 428 CDS 100% 15.000 10.500 N ZNF627 n/a
5 TRCN0000229738 CACACTGGACGTGAACCAAAT pLKO_005 463 CDS 100% 10.800 7.560 N ZNF627 n/a
6 TRCN0000016722 GCTTCAGTTGTCCCAGTTCTT pLKO.1 1456 CDS 100% 4.950 3.465 N ZNF627 n/a
7 TRCN0000016721 CGAATGTAAACAGTGCGGTAA pLKO.1 933 CDS 100% 4.050 2.835 N ZNF627 n/a
8 TRCN0000016718 GCCTTTGATTATCCCAGTTTA pLKO.1 703 CDS 100% 13.200 7.920 N ZNF627 n/a
9 TRCN0000229740 TCAGTCGATCCACTTACTTTC pLKO_005 1379 CDS 100% 10.800 6.480 N ZNF627 n/a
10 TRCN0000016720 CCAGAACATTGAAGACCCATT pLKO.1 243 CDS 100% 4.050 2.430 N ZNF627 n/a
11 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1252 CDS 100% 15.000 7.500 Y ZNF443 n/a
12 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1252 CDS 100% 15.000 7.500 Y Zfp97 n/a
13 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 749 CDS 100% 5.625 2.813 Y ZNF345 n/a
14 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1338 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.