Transcript: Human XM_011527838.3

PREDICTED: Homo sapiens Rho/Rac guanine nucleotide exchange factor 18 (ARHGEF18), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF18 (23370)
Length:
6281
CDS:
9..4094

Additional Resources:

NCBI RefSeq record:
XM_011527838.3
NBCI Gene record:
ARHGEF18 (23370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527838.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047534 GCCGGAGATGTATGAAATCTA pLKO.1 2288 CDS 100% 5.625 7.875 N ARHGEF18 n/a
2 TRCN0000296254 CCTGGTTACACAACGCATAAC pLKO_005 1799 CDS 100% 10.800 8.640 N ARHGEF18 n/a
3 TRCN0000296253 CTCCAAACACCGAGTCCATTT pLKO_005 1198 CDS 100% 10.800 7.560 N ARHGEF18 n/a
4 TRCN0000308158 TTTGGAAGCCCATCGTGAAAG pLKO_005 4763 3UTR 100% 10.800 7.560 N ARHGEF18 n/a
5 TRCN0000047535 CGGACCAATCACAGGAGAGAT pLKO.1 1112 CDS 100% 4.950 3.465 N ARHGEF18 n/a
6 TRCN0000047536 GAATGGCAGTTTCAAGAAGAA pLKO.1 2780 CDS 100% 4.950 3.465 N ARHGEF18 n/a
7 TRCN0000289759 GAATGGCAGTTTCAAGAAGAA pLKO_005 2780 CDS 100% 4.950 3.465 N ARHGEF18 n/a
8 TRCN0000047533 CCGGAATTATGTCATCCAGAA pLKO.1 1574 CDS 100% 4.050 2.835 N ARHGEF18 n/a
9 TRCN0000047537 GCTTGAAAGATATCCTGGCTA pLKO.1 2104 CDS 100% 2.640 1.848 N ARHGEF18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527838.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.