Transcript: Human XM_011527845.1

PREDICTED: Homo sapiens phosphatidylinositol-4-phosphate 5-kinase type 1 gamma (PIP5K1C), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIP5K1C (23396)
Length:
2399
CDS:
97..2292

Additional Resources:

NCBI RefSeq record:
XM_011527845.1
NBCI Gene record:
PIP5K1C (23396)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037668 CAACACGGTCTTTCGGAAGAA pLKO.1 1416 CDS 100% 4.950 6.930 N PIP5K1C n/a
2 TRCN0000037665 CGGCGAAACCACCTACAAGAA pLKO.1 294 CDS 100% 4.950 6.930 N PIP5K1C n/a
3 TRCN0000199143 CCAACAGAGGTTCTGTCCATG pLKO.1 214 CDS 100% 4.050 5.670 N PIP5K1C n/a
4 TRCN0000195424 CTTTCGAAGAAGCCACTACAG pLKO.1 1640 CDS 100% 4.050 5.670 N PIP5K1C n/a
5 TRCN0000037666 CGTGGTCAAGATGCACCTCAA pLKO.1 828 CDS 100% 4.050 3.240 N PIP5K1C n/a
6 TRCN0000037664 GCAGTCCTACAGGTTCATCAA pLKO.1 1296 CDS 100% 4.950 3.465 N PIP5K1C n/a
7 TRCN0000037667 CGATGAGAGGAGCTGGGTGTA pLKO.1 2321 3UTR 100% 1.350 0.945 N PIP5K1C n/a
8 TRCN0000199413 CGCCACCTTCTTTCGAAGAAG pLKO.1 1631 CDS 100% 0.495 0.347 N PIP5K1C n/a
9 TRCN0000363133 TCATGAGCAACACGGTCTTTC pLKO_005 1409 CDS 100% 10.800 6.480 N PIP5K1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.