Transcript: Human XM_011528042.2

PREDICTED: Homo sapiens collagen type V alpha 3 chain (COL5A3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL5A3 (50509)
Length:
6232
CDS:
148..5382

Additional Resources:

NCBI RefSeq record:
XM_011528042.2
NBCI Gene record:
COL5A3 (50509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117051 CCTACTGGCTTAAAGGGTGAT pLKO.1 3112 CDS 100% 4.050 5.670 N COL5A3 n/a
2 TRCN0000422530 GGCTTTGAAGCCACCGTATTT pLKO_005 5443 3UTR 100% 13.200 10.560 N COL5A3 n/a
3 TRCN0000117049 CATTGGATTGATCGGTCTCAT pLKO.1 4356 CDS 100% 4.950 3.960 N COL5A3 n/a
4 TRCN0000117048 CCTGGACCTAAGGGATCTATT pLKO.1 2539 CDS 100% 13.200 9.240 N COL5A3 n/a
5 TRCN0000430957 AGACTTTCGAGGGAGACATTC pLKO_005 728 CDS 100% 10.800 7.560 N COL5A3 n/a
6 TRCN0000117050 CCCTGGACCTAAGGGATCTAT pLKO.1 2538 CDS 100% 5.625 3.938 N COL5A3 n/a
7 TRCN0000117047 CCTTTCTACTTCCACGGTGAA pLKO.1 5846 3UTR 100% 4.050 2.430 N COL5A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528042.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.