Transcript: Human XM_011528169.2

PREDICTED: Homo sapiens regulatory factor X1 (RFX1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFX1 (5989)
Length:
4303
CDS:
196..3138

Additional Resources:

NCBI RefSeq record:
XM_011528169.2
NBCI Gene record:
RFX1 (5989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234633 TACTATGGCCTGCGCATCAAG pLKO_005 1714 CDS 100% 4.950 6.930 N RFX1 n/a
2 TRCN0000358443 TGTACATGACGAGGCCGAGAA pLKO_005 2157 CDS 100% 4.050 5.670 N RFX1 n/a
3 TRCN0000014816 GCAGGCACCTACGTGATCCAA pLKO.1 1426 CDS 100% 1.000 1.400 N RFX1 n/a
4 TRCN0000234635 CGTGCGAAACTGTTAACTTAT pLKO_005 3493 3UTR 100% 13.200 10.560 N RFX1 n/a
5 TRCN0000234634 ACCCAAGCGATCCGGAACTTT pLKO_005 2320 CDS 100% 5.625 4.500 N RFX1 n/a
6 TRCN0000014813 GCCTGTGAGATAGATGTTTAT pLKO.1 4051 3UTR 100% 13.200 9.240 N RFX1 n/a
7 TRCN0000420753 TGGTATTAAGTGCAATTAAAG pLKO_005 3657 3UTR 100% 13.200 9.240 N Rfx1 n/a
8 TRCN0000234632 CCCTCTACTGCCACTACTTAC pLKO_005 1571 CDS 100% 10.800 7.560 N RFX1 n/a
9 TRCN0000234631 GTTCCAGCACCTACTCCTATC pLKO_005 1130 CDS 100% 6.000 4.200 N RFX1 n/a
10 TRCN0000358375 TTATTCAGCTCGCTGGCTTTG pLKO_005 3510 3UTR 100% 6.000 4.200 N RFX1 n/a
11 TRCN0000358460 CAGTGGCTCCTGGACAACTAT pLKO_005 1516 CDS 100% 5.625 3.938 N RFX1 n/a
12 TRCN0000014814 GAAGACCTTCTGGAGGTACAA pLKO.1 2103 CDS 100% 4.950 3.465 N RFX1 n/a
13 TRCN0000358458 AGTACATGTACTACCTGATCG pLKO_005 2849 CDS 100% 4.050 2.835 N RFX1 n/a
14 TRCN0000014817 GCCACTCCACAAGCGCCCAAA pLKO.1 622 CDS 100% 0.000 0.000 N RFX1 n/a
15 TRCN0000014815 CCTCCTCAAGTGGTCCTTCTA pLKO.1 2745 CDS 100% 4.950 2.970 N RFX1 n/a
16 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 2975 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.