Transcript: Human XM_011528486.2

PREDICTED: Homo sapiens regulator of G protein signaling 19 (RGS19), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS19 (10287)
Length:
1525
CDS:
200..853

Additional Resources:

NCBI RefSeq record:
XM_011528486.2
NBCI Gene record:
RGS19 (10287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036491 GAGGCTCATCTACGAGGACTA pLKO.1 616 CDS 100% 4.050 5.670 N RGS19 n/a
2 TRCN0000300428 GAGGCTCATCTACGAGGACTA pLKO_005 616 CDS 100% 4.050 5.670 N RGS19 n/a
3 TRCN0000310804 CAGAACCTCAGAACCAGATTT pLKO_005 1322 3UTR 100% 13.200 9.240 N RGS19 n/a
4 TRCN0000036489 CCCTTCAATGTCCAGTCATGA pLKO.1 259 CDS 100% 4.950 3.465 N RGS19 n/a
5 TRCN0000300359 CCCTTCAATGTCCAGTCATGA pLKO_005 259 CDS 100% 4.950 3.465 N RGS19 n/a
6 TRCN0000036493 CAGCGAGGAGAACATGCTCTT pLKO.1 535 CDS 100% 4.050 2.835 N RGS19 n/a
7 TRCN0000300429 CAGCGAGGAGAACATGCTCTT pLKO_005 535 CDS 100% 4.050 2.835 N RGS19 n/a
8 TRCN0000036492 GCTGCAGATCTACACGCTCAT pLKO.1 742 CDS 100% 4.050 2.835 N RGS19 n/a
9 TRCN0000300427 GCTGCAGATCTACACGCTCAT pLKO_005 742 CDS 100% 4.050 2.835 N RGS19 n/a
10 TRCN0000036490 GTGAAGTATGTGCCACGCCAA pLKO.1 417 CDS 100% 2.160 1.512 N RGS19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.