Transcript: Human XM_011528496.1

PREDICTED: Homo sapiens protein C receptor (PROCR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PROCR (10544)
Length:
759
CDS:
62..673

Additional Resources:

NCBI RefSeq record:
XM_011528496.1
NBCI Gene record:
PROCR (10544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061378 TGGCCTCCAAAGACTTCATAT pLKO.1 130 CDS 100% 13.200 9.240 N PROCR n/a
2 TRCN0000300564 TGGCCTCCAAAGACTTCATAT pLKO_005 130 CDS 100% 13.200 9.240 N PROCR n/a
3 TRCN0000061379 GTGCAGTATGTGCAGAAACAT pLKO.1 620 CDS 100% 5.625 3.938 N PROCR n/a
4 TRCN0000061380 GCAGCAGCTCAATGCCTACAA pLKO.1 556 CDS 100% 4.950 3.465 N PROCR n/a
5 TRCN0000300553 GCAGCAGCTCAATGCCTACAA pLKO_005 556 CDS 100% 4.950 3.465 N PROCR n/a
6 TRCN0000061381 AGAGCCCATGTCTTCTTCGAA pLKO.1 437 CDS 100% 3.000 2.100 N PROCR n/a
7 TRCN0000061382 TCGGTATGAACTGCGGGAATT pLKO.1 583 CDS 100% 0.000 0.000 N PROCR n/a
8 TRCN0000300554 TCGGTATGAACTGCGGGAATT pLKO_005 583 CDS 100% 0.000 0.000 N PROCR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07632 pDONR223 100% 84.8% 84% None (many diffs) n/a
2 ccsbBroad304_07632 pLX_304 0% 84.8% 84% V5 (many diffs) n/a
Download CSV