Transcript: Human XM_011528867.2

PREDICTED: Homo sapiens phospholipase C gamma 1 (PLCG1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCG1 (5335)
Length:
2966
CDS:
122..2842

Additional Resources:

NCBI RefSeq record:
XM_011528867.2
NBCI Gene record:
PLCG1 (5335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226429 CCGGATGGGATGCCAGTTATT pLKO_005 1235 CDS 100% 13.200 18.480 N PLCG1 n/a
2 TRCN0000226428 GGAATCGTGAGGATCGTATAT pLKO_005 618 CDS 100% 13.200 18.480 N PLCG1 n/a
3 TRCN0000380300 TGAGTTTGAGATGCGACTTTC pLKO_005 2062 CDS 100% 10.800 15.120 N PLCG1 n/a
4 TRCN0000006978 GCCATTGACATTCGTGAAATT pLKO.1 335 CDS 100% 13.200 9.240 N PLCG1 n/a
5 TRCN0000226427 GCCATTGACATTCGTGAAATT pLKO_005 335 CDS 100% 13.200 9.240 N PLCG1 n/a
6 TRCN0000011060 CCAGTCACATTGCTTTGTCAT pLKO.1 427 CDS 100% 4.950 3.465 N PLCG1 n/a
7 TRCN0000006980 CCTGTGAACCACGAATGGTAT pLKO.1 1619 CDS 100% 4.950 3.465 N PLCG1 n/a
8 TRCN0000024976 CCAACTTTCAAGTGTGCAGTA pLKO.1 2489 CDS 100% 4.050 2.835 N Plcg1 n/a
9 TRCN0000298134 CCAACTTTCAAGTGTGCAGTA pLKO_005 2489 CDS 100% 4.050 2.835 N Plcg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.