Transcript: Human XM_011528904.1

PREDICTED: Homo sapiens docking protein 5 (DOK5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOK5 (55816)
Length:
1717
CDS:
429..1025

Additional Resources:

NCBI RefSeq record:
XM_011528904.1
NBCI Gene record:
DOK5 (55816)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414373 GCGAATGTGCCTTGCAGATTA pLKO_005 562 CDS 100% 13.200 18.480 N DOK5 n/a
2 TRCN0000121829 GCGATGCTGGTTAGTATTCAA pLKO.1 179 5UTR 100% 5.625 4.500 N DOK5 n/a
3 TRCN0000143803 GTTTATCTTTCAGACCCGAGA pLKO.1 728 CDS 100% 2.160 1.728 N DOK5 n/a
4 TRCN0000431466 ACATGCCATAGGGATTTATTT pLKO_005 335 5UTR 100% 15.000 10.500 N DOK5 n/a
5 TRCN0000430763 TGATGAACGTGCTGCATATTT pLKO_005 242 5UTR 100% 15.000 10.500 N DOK5 n/a
6 TRCN0000426447 GCTTAAAGTCCTGGCTAATTG pLKO_005 1129 3UTR 100% 13.200 9.240 N DOK5 n/a
7 TRCN0000143021 GAATCCCAGAGTCAAACTCAT pLKO.1 614 CDS 100% 4.950 3.465 N DOK5 n/a
8 TRCN0000144662 GTATTTGATGCCATCTCCTAA pLKO.1 527 CDS 100% 4.950 3.465 N DOK5 n/a
9 TRCN0000139436 CCTCTGAAGCTTCATCGAACA pLKO.1 972 CDS 100% 4.050 2.835 N DOK5 n/a
10 TRCN0000191393 CCATCTCCTAACTTAGATGTA pLKO.1 537 CDS 100% 0.495 0.347 N Dok5 n/a
11 TRCN0000143811 GCCATCTCCTAACTTAGATGT pLKO.1 536 CDS 100% 0.495 0.347 N DOK5 n/a
12 TRCN0000140603 GTACTCCAGATGGAGTGTGTA pLKO.1 420 5UTR 100% 0.495 0.347 N DOK5 n/a
13 TRCN0000143606 GAATCAGATCTTGAGGCTGAT pLKO.1 387 5UTR 100% 0.405 0.284 N DOK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528904.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.