Transcript: Human XM_011529138.1

PREDICTED: Homo sapiens RANBP2-type and C3HC4-type zinc finger containing 1 (RBCK1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBCK1 (10616)
Length:
2651
CDS:
460..2115

Additional Resources:

NCBI RefSeq record:
XM_011529138.1
NBCI Gene record:
RBCK1 (10616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007599 CCACAACACTCATCTGTCAAA pLKO.1 2408 3UTR 100% 4.950 6.930 N RBCK1 n/a
2 TRCN0000338233 CCACAACACTCATCTGTCAAA pLKO_005 2408 3UTR 100% 4.950 6.930 N RBCK1 n/a
3 TRCN0000338235 CAGAACTGCCACTGAGCTAAA pLKO_005 2101 CDS 100% 10.800 7.560 N RBCK1 n/a
4 TRCN0000338176 TCTTTGAGGATGATGTCAATG pLKO_005 1724 CDS 100% 10.800 7.560 N RBCK1 n/a
5 TRCN0000338234 CAGTGCCTTCAGCTACCATTG pLKO_005 1674 CDS 100% 6.000 4.200 N RBCK1 n/a
6 TRCN0000007602 CCCTGAGGATTACCAGCGATT pLKO.1 1620 CDS 100% 4.050 2.835 N RBCK1 n/a
7 TRCN0000338232 CCCTGAGGATTACCAGCGATT pLKO_005 1620 CDS 100% 4.050 2.835 N RBCK1 n/a
8 TRCN0000007601 GCAGATGAACTGCAAGGAGTA pLKO.1 1803 CDS 100% 4.050 2.835 N RBCK1 n/a
9 TRCN0000007600 GCAGGGTAAATGGGATTCCTT pLKO.1 2066 CDS 100% 3.000 2.100 N RBCK1 n/a
10 TRCN0000007603 GCCCTGATATGACAGTGGCGT pLKO.1 809 CDS 100% 0.220 0.154 N RBCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11529 pDONR223 100% 41% 36.2% None (many diffs) n/a
2 ccsbBroad304_11529 pLX_304 0% 41% 36.2% V5 (many diffs) n/a
Download CSV