Transcript: Human XM_011529180.2

PREDICTED: Homo sapiens shieldin complex subunit 1 (SHLD1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHLD1 (149840)
Length:
590
CDS:
56..283

Additional Resources:

NCBI RefSeq record:
XM_011529180.2
NBCI Gene record:
SHLD1 (149840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425344 AGCGTGTGACATAAGAGATTA pLKO_005 160 CDS 100% 13.200 9.240 N SHLD1 n/a
2 TRCN0000135612 GAGGCTTTCAGTTCTTTGGAA pLKO.1 215 CDS 100% 3.000 2.100 N SHLD1 n/a
3 TRCN0000442808 TGTCAGAGGAGAGCAGTGCTT pLKO_005 126 CDS 100% 2.640 1.848 N SHLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05033 pDONR223 100% 28.1% 27.5% None (many diffs) n/a
2 ccsbBroad304_05033 pLX_304 0% 28.1% 27.5% V5 (many diffs) n/a
Download CSV