Transcript: Human XM_011529446.2

PREDICTED: Homo sapiens heat shock transcription factor 2 binding protein (HSF2BP), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HSF2BP (11077)
Length:
1749
CDS:
402..1181

Additional Resources:

NCBI RefSeq record:
XM_011529446.2
NBCI Gene record:
HSF2BP (11077)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017475 CGGATGAAAGTCAGTTTGTTT pLKO.1 706 CDS 100% 5.625 7.875 N HSF2BP n/a
2 TRCN0000017473 GCTGGAATTGTCACGAATGTT pLKO.1 735 CDS 100% 5.625 7.875 N HSF2BP n/a
3 TRCN0000017476 GCTAATGCTGATGTCCCTATA pLKO.1 869 CDS 100% 10.800 8.640 N HSF2BP n/a
4 TRCN0000229705 GGTGCTCTTGGACACCATATT pLKO_005 800 CDS 100% 13.200 9.240 N HSF2BP n/a
5 TRCN0000218198 ATTCGGATGAAAGTCAGTTTG pLKO_005 703 CDS 100% 10.800 7.560 N HSF2BP n/a
6 TRCN0000017477 CGACAACATAAGAGAGAAGAA pLKO.1 446 CDS 100% 4.950 3.465 N HSF2BP n/a
7 TRCN0000229707 ACCTGTAGGTTCACCTATAAA pLKO_005 1494 3UTR 100% 15.000 7.500 Y HSF2BP n/a
8 TRCN0000229706 CTCCGCACTCTGGAGCATAAT pLKO_005 1155 CDS 100% 13.200 6.600 Y HSF2BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.