Transcript: Human XM_011529612.2

PREDICTED: Homo sapiens bromodomain and WD repeat domain containing 1 (BRWD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRWD1 (54014)
Length:
9004
CDS:
32..6154

Additional Resources:

NCBI RefSeq record:
XM_011529612.2
NBCI Gene record:
BRWD1 (54014)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358427 ACTCGAAAGAGAGTCTATTTA pLKO_005 3983 CDS 100% 15.000 21.000 N BRWD1 n/a
2 TRCN0000368527 CTGACTATCGACCACTTATTA pLKO_005 876 CDS 100% 15.000 21.000 N BRWD1 n/a
3 TRCN0000062665 GCTGATATTTAGCAATGCAAA pLKO.1 3340 CDS 100% 4.950 3.960 N BRWD1 n/a
4 TRCN0000062663 GCCTGCTATAAGACTACTATT pLKO.1 6397 3UTR 100% 13.200 9.240 N BRWD1 n/a
5 TRCN0000062666 GCGTGAGTTATCTTCTGGAAA pLKO.1 1627 CDS 100% 4.950 3.465 N BRWD1 n/a
6 TRCN0000084534 GCAGCATATTTATATGGGATA pLKO.1 663 CDS 100% 4.050 2.835 N Brwd1 n/a
7 TRCN0000301846 GCAGCATATTTATATGGGATA pLKO_005 663 CDS 100% 4.050 2.835 N Brwd1 n/a
8 TRCN0000358426 GGACATGATGGCAGCATATTT pLKO_005 653 CDS 100% 15.000 9.000 N BRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.