Transcript: Human XM_011530237.2

PREDICTED: Homo sapiens mitochondrial elongation factor 1 (MIEF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIEF1 (54471)
Length:
5794
CDS:
593..1984

Additional Resources:

NCBI RefSeq record:
XM_011530237.2
NBCI Gene record:
MIEF1 (54471)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275295 TAGTGGCTGGCTCCATCAATT pLKO_005 1398 CDS 100% 13.200 10.560 N MIEF1 n/a
2 TRCN0000155647 CAGCCAGCTAACCAATGTCAT pLKO.1 1738 CDS 100% 4.950 3.465 N MIEF1 n/a
3 TRCN0000275348 CAGCCAGCTAACCAATGTCAT pLKO_005 1738 CDS 100% 4.950 3.465 N MIEF1 n/a
4 TRCN0000155976 CCAAAGACAGTCGCAGATACA pLKO.1 1367 CDS 100% 4.950 3.465 N MIEF1 n/a
5 TRCN0000150579 GCAGGAGAAACTTCTTACTTA pLKO.1 997 CDS 100% 5.625 3.375 N MIEF1 n/a
6 TRCN0000275347 GCAGGAGAAACTTCTTACTTA pLKO_005 997 CDS 100% 5.625 3.375 N MIEF1 n/a
7 TRCN0000152113 CCAACGATAGTAACAGGAAAT pLKO.1 3540 3UTR 100% 10.800 5.400 Y MIEF1 n/a
8 TRCN0000154560 GCTGCCATCTTCCTCATCATA pLKO.1 4635 3UTR 100% 5.625 2.813 Y MIEF1 n/a
9 TRCN0000152248 CCCATTCATAAATGCTGAGAA pLKO.1 2603 3UTR 100% 4.950 2.475 Y MIEF1 n/a
10 TRCN0000275294 CCCATTCATAAATGCTGAGAA pLKO_005 2603 3UTR 100% 4.950 2.475 Y MIEF1 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4140 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4140 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4140 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000202232 CCATCATGAATGTCCCTGGTT pLKO.1 1260 CDS 100% 2.640 1.848 N Mief1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.