Transcript: Human XM_011530458.2

PREDICTED: Homo sapiens myosin XVIIIB (MYO18B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO18B (84700)
Length:
8316
CDS:
270..8102

Additional Resources:

NCBI RefSeq record:
XM_011530458.2
NBCI Gene record:
MYO18B (84700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117371 CGACGATGTTGCGAGCATAAT pLKO.1 8060 CDS 100% 13.200 18.480 N MYO18B n/a
2 TRCN0000417032 TACTCTTGCTACGGTGCTAAA pLKO_005 1967 CDS 100% 10.800 15.120 N MYO18B n/a
3 TRCN0000117368 CCACAGATACTGGAAAGGAAA pLKO.1 946 CDS 100% 4.950 3.960 N MYO18B n/a
4 TRCN0000435791 AGATGCTACAGGACCATAAAC pLKO_005 5386 CDS 100% 13.200 9.240 N MYO18B n/a
5 TRCN0000437199 GTCTCCACGCTACAGCGATAT pLKO_005 3348 CDS 100% 10.800 7.560 N MYO18B n/a
6 TRCN0000117369 CCAGCCTCAAATGCATCTCTT pLKO.1 7369 CDS 100% 4.950 3.465 N MYO18B n/a
7 TRCN0000117370 GCTCTTAAGTAAGGCAGAGAA pLKO.1 1415 CDS 100% 4.950 3.465 N MYO18B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12841 pDONR223 100% 98.1% 98.1% None (many diffs) n/a
2 ccsbBroad304_12841 pLX_304 0% 98.1% 98.1% V5 (many diffs) n/a
Download CSV