Transcript: Human XM_011530553.1

PREDICTED: Homo sapiens cadherin EGF LAG seven-pass G-type receptor 1 (CELSR1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CELSR1 (9620)
Length:
7130
CDS:
333..6815

Additional Resources:

NCBI RefSeq record:
XM_011530553.1
NBCI Gene record:
CELSR1 (9620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285045 ACAACGGCATCCCGCAGAAAT pLKO_005 2929 CDS 100% 13.200 9.240 N CELSR1 n/a
2 TRCN0000356765 ACTACAACAAGCCCAATATTG pLKO_005 4933 CDS 100% 13.200 9.240 N CELSR1 n/a
3 TRCN0000011238 CCAGAAATACTCGCTGAGCAT pLKO.1 1913 CDS 100% 2.640 1.848 N CELSR1 n/a
4 TRCN0000273859 CCAGAAATACTCGCTGAGCAT pLKO_005 1913 CDS 100% 2.640 1.848 N CELSR1 n/a
5 TRCN0000008241 CCCATGTTTGAGAAGGACGAA pLKO.1 3321 CDS 100% 2.640 1.848 N CELSR1 n/a
6 TRCN0000285066 CCCATGTTTGAGAAGGACGAA pLKO_005 3321 CDS 100% 2.640 1.848 N CELSR1 n/a
7 TRCN0000008242 CCTGTGTCAACAGGTGGAATA pLKO.1 5320 CDS 100% 1.080 0.756 N CELSR1 n/a
8 TRCN0000273805 CCTGTGTCAACAGGTGGAATA pLKO_005 5320 CDS 100% 1.080 0.756 N CELSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.