Transcript: Human XM_011530700.2

PREDICTED: Homo sapiens Mov10 like RISC complex RNA helicase 1 (MOV10L1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MOV10L1 (54456)
Length:
4455
CDS:
585..4199

Additional Resources:

NCBI RefSeq record:
XM_011530700.2
NBCI Gene record:
MOV10L1 (54456)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427949 AGCCTCACGCTTCCGGATAAT pLKO_005 2987 CDS 100% 13.200 18.480 N MOV10L1 n/a
2 TRCN0000413728 AGGTTCGAGGAGATAGTTATT pLKO_005 2922 CDS 100% 13.200 18.480 N MOV10L1 n/a
3 TRCN0000432780 CAAGGTACTGCAGCGATTATG pLKO_005 562 5UTR 100% 13.200 18.480 N MOV10L1 n/a
4 TRCN0000052068 CGGTCAAATGAAGATAGATTT pLKO.1 3891 CDS 100% 13.200 18.480 N MOV10L1 n/a
5 TRCN0000052071 GCTGGGATAAATCTAAACAAT pLKO.1 1360 CDS 100% 5.625 7.875 N MOV10L1 n/a
6 TRCN0000435165 ATGTTGATCTGATGGATATAA pLKO_005 3808 CDS 100% 15.000 12.000 N MOV10L1 n/a
7 TRCN0000052072 CGTCATCCACTTAGGTGTAAA pLKO.1 2375 CDS 100% 13.200 10.560 N MOV10L1 n/a
8 TRCN0000430872 GAATTTGAACAAGCCTATAAC pLKO_005 2283 CDS 100% 13.200 9.240 N MOV10L1 n/a
9 TRCN0000052069 GCTGGAATACAGTATTACAAA pLKO.1 4046 CDS 100% 5.625 3.938 N MOV10L1 n/a
10 TRCN0000052070 CCCAATATCCAATCCCAGATA pLKO.1 1915 CDS 100% 4.950 3.465 N MOV10L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.