Transcript: Human XM_011530888.2

PREDICTED: Homo sapiens acyl-CoA synthetase long chain family member 4 (ACSL4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSL4 (2182)
Length:
3942
CDS:
248..2383

Additional Resources:

NCBI RefSeq record:
XM_011530888.2
NBCI Gene record:
ACSL4 (2182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045541 GCAGTAGTTCATGGGCTAAAT pLKO.1 809 CDS 100% 13.200 9.240 N ACSL4 n/a
2 TRCN0000011984 GCCATGAAATTGGAGCGATTT pLKO.1 2222 CDS 100% 10.800 7.560 N Acsl4 n/a
3 TRCN0000278172 GCCATGAAATTGGAGCGATTT pLKO_005 2222 CDS 100% 10.800 7.560 N Acsl4 n/a
4 TRCN0000045539 CCAGTGTTGAACTTCTGGAAA pLKO.1 855 CDS 100% 4.950 3.465 N ACSL4 n/a
5 TRCN0000045542 CCTCAAAGACATTGAACGAAT pLKO.1 2347 CDS 100% 4.950 3.465 N ACSL4 n/a
6 TRCN0000045540 GCAGGAGAGTATGTATCTCTT pLKO.1 1982 CDS 100% 4.950 3.465 N ACSL4 n/a
7 TRCN0000045538 CCGGAAATCATGGATAGAATT pLKO.1 1370 CDS 100% 0.000 0.000 N ACSL4 n/a
8 TRCN0000011986 GCAGAGTGAATAACTTTGGAA pLKO.1 645 CDS 100% 3.000 4.200 N Acsl4 n/a
9 TRCN0000278174 GCAGAGTGAATAACTTTGGAA pLKO_005 645 CDS 100% 3.000 4.200 N Acsl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06194 pDONR223 100% 94.1% 94.2% None 1_123del;1764A>G n/a
Download CSV