Transcript: Human XM_011531027.2

PREDICTED: Homo sapiens MORC family CW-type zinc finger 4 (MORC4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MORC4 (79710)
Length:
3556
CDS:
95..2377

Additional Resources:

NCBI RefSeq record:
XM_011531027.2
NBCI Gene record:
MORC4 (79710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531027.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135811 CGAAGATGTAACAATCTCGTT pLKO.1 2804 3UTR 100% 2.640 3.696 N MORC4 n/a
2 TRCN0000138413 CCCATCCAAAGTACAGGAGAT pLKO.1 933 CDS 100% 4.050 3.240 N MORC4 n/a
3 TRCN0000137312 GAGGCAAATCACATACTGGAT pLKO.1 2354 CDS 100% 2.640 2.112 N MORC4 n/a
4 TRCN0000138443 CCAAGATTGGTGGCAGAAGAA pLKO.1 1562 CDS 100% 4.950 3.465 N MORC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531027.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.