Transcript: Human XM_011531269.2

PREDICTED: Homo sapiens adhesion G protein-coupled receptor G4 (ADGRG4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRG4 (139378)
Length:
9693
CDS:
298..9540

Additional Resources:

NCBI RefSeq record:
XM_011531269.2
NBCI Gene record:
ADGRG4 (139378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357073 CAAGATCAATTGACGTTATTA pLKO_005 7387 CDS 100% 15.000 21.000 N ADGRG4 n/a
2 TRCN0000357072 GGCAACGTCCACTCCTATTTA pLKO_005 4809 CDS 100% 15.000 21.000 N ADGRG4 n/a
3 TRCN0000011532 GCTGACGTTAAGCACACATTT pLKO.1 6202 CDS 100% 13.200 10.560 N ADGRG4 n/a
4 TRCN0000011529 CCGGAACTGTACCTTGGTTTA pLKO.1 1625 CDS 100% 10.800 8.640 N ADGRG4 n/a
5 TRCN0000011528 GCTGGGATAGTGACTCCATTT pLKO.1 5290 CDS 100% 10.800 8.640 N ADGRG4 n/a
6 TRCN0000368470 GATGGTGTGAAGGGCAAATTA pLKO_005 676 CDS 100% 15.000 10.500 N ADGRG4 n/a
7 TRCN0000011531 GCAGCTAATACTATACAGATT pLKO.1 588 CDS 100% 4.950 3.465 N ADGRG4 n/a
8 TRCN0000011530 CCTGACAAGATTGTGGATCTT pLKO.1 7651 CDS 100% 0.495 0.347 N ADGRG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.