Transcript: Human XM_011531617.3

PREDICTED: Homo sapiens ankyrin repeat and SOCS box containing 5 (ASB5), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASB5 (140458)
Length:
3723
CDS:
966..1796

Additional Resources:

NCBI RefSeq record:
XM_011531617.3
NBCI Gene record:
ASB5 (140458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427785 GCTAACTTGTTACTGATATTG pLKO_005 2191 3UTR 100% 13.200 18.480 N ASB5 n/a
2 TRCN0000138878 GCTGACGTACAGAAAGGCAAA pLKO.1 1479 CDS 100% 4.050 3.240 N ASB5 n/a
3 TRCN0000418942 GATGGCGTGACTCCGTTATTC pLKO_005 1209 CDS 100% 13.200 9.240 N ASB5 n/a
4 TRCN0000134768 GCTTAGCAAAGAGCAACTAAT pLKO.1 2230 3UTR 100% 13.200 9.240 N ASB5 n/a
5 TRCN0000421023 ACAGAGCTTCTGCGACCTATA pLKO_005 1596 CDS 100% 10.800 7.560 N ASB5 n/a
6 TRCN0000134700 GCATAGATGTTGACCAAGAAA pLKO.1 1378 CDS 100% 5.625 3.938 N ASB5 n/a
7 TRCN0000133675 GAGAACTTAATCGCACTGTTT pLKO.1 2789 3UTR 100% 4.950 3.465 N ASB5 n/a
8 TRCN0000134271 GCAAGTAATAGCAAGAGAGTA pLKO.1 2855 3UTR 100% 4.950 3.465 N ASB5 n/a
9 TRCN0000137235 GTAGCTTGTATGTCACAGCAA pLKO.1 1425 CDS 100% 2.640 1.848 N ASB5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.