Transcript: Human XM_011531671.2

PREDICTED: Homo sapiens chromosome 4 open reading frame 45 (C4orf45), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C4orf45 (152940)
Length:
852
CDS:
142..681

Additional Resources:

NCBI RefSeq record:
XM_011531671.2
NBCI Gene record:
C4orf45 (152940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134297 GTTGGAGAATACCACAGTATA pLKO.1 353 CDS 100% 13.200 10.560 N C4orf45 n/a
2 TRCN0000134403 GTCAAGCTTCTCTTGATTCAA pLKO.1 431 CDS 100% 0.563 0.450 N C4orf45 n/a
3 TRCN0000414854 CAAGCTTCTCTTGATTCAATA pLKO_005 433 CDS 100% 13.200 9.240 N C4orf45 n/a
4 TRCN0000430373 AGAGCTTCCAAACCACCTAAG pLKO_005 619 CDS 100% 6.000 4.200 N C4orf45 n/a
5 TRCN0000440416 GAGAACAGCATCTGGCGTTAG pLKO_005 242 CDS 100% 6.000 4.200 N C4orf45 n/a
6 TRCN0000133776 CCAAATGGGCTATTCTTGTTA pLKO.1 575 CDS 100% 5.625 3.938 N C4orf45 n/a
7 TRCN0000136329 CAGCATAACTCAACCTGCTTT pLKO.1 691 3UTR 100% 4.950 3.465 N C4orf45 n/a
8 TRCN0000136886 CGAGGACACTGATCAGAGAAA pLKO.1 552 CDS 100% 4.950 3.465 N C4orf45 n/a
9 TRCN0000134701 GAGAAATTCCAAATGGGCTAT pLKO.1 567 CDS 100% 4.050 2.835 N C4orf45 n/a
10 TRCN0000134123 CACTGATCAGAGAAATTCCAA pLKO.1 558 CDS 100% 3.000 2.100 N C4orf45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.