Transcript: Human XM_011531943.2

PREDICTED: Homo sapiens coiled-coil serine rich protein 1 (CCSER1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCSER1 (401145)
Length:
5078
CDS:
480..2825

Additional Resources:

NCBI RefSeq record:
XM_011531943.2
NBCI Gene record:
CCSER1 (401145)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168115 CGGCAGTCAAGACGTTATTAT pLKO.1 2461 CDS 100% 15.000 21.000 N CCSER1 n/a
2 TRCN0000420884 GTCTCCCGGTTGCCAATATTC pLKO_005 513 CDS 100% 13.200 18.480 N CCSER1 n/a
3 TRCN0000438601 GGTAAACGGAGGAGCATATTC pLKO_005 648 CDS 100% 13.200 10.560 N CCSER1 n/a
4 TRCN0000417084 ACCAACCAGAACCTTAGTATT pLKO_005 726 CDS 100% 13.200 9.240 N CCSER1 n/a
5 TRCN0000167230 CAGAAGGAAGTGTTATTACAA pLKO.1 1512 CDS 100% 5.625 3.938 N CCSER1 n/a
6 TRCN0000168318 GTCCATTTCGTGAAGGAAGAT pLKO.1 1822 CDS 100% 4.950 3.465 N CCSER1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531943.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05643 pDONR223 100% 86% 85.7% None (many diffs) n/a
Download CSV