Transcript: Human XM_011532133.2

PREDICTED: Homo sapiens PR/SET domain 8 (PRDM8), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRDM8 (56978)
Length:
4138
CDS:
429..3341

Additional Resources:

NCBI RefSeq record:
XM_011532133.2
NBCI Gene record:
PRDM8 (56978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358531 GGCACATGACCTCGCATAATT pLKO_005 3319 CDS 100% 15.000 21.000 N PRDM8 n/a
2 TRCN0000016758 CCTGAGCCATACTTCCCTATA pLKO.1 1403 CDS 100% 10.800 15.120 N PRDM8 n/a
3 TRCN0000016762 GTACCGTATATCTTTCGGGTA pLKO.1 1470 CDS 100% 0.000 0.000 N PRDM8 n/a
4 TRCN0000358530 GACTTCACAGCGCTGATATAA pLKO_005 1813 CDS 100% 15.000 10.500 N PRDM8 n/a
5 TRCN0000367872 AGAACCTTGAAGCCTACATAA pLKO_005 1570 CDS 100% 13.200 9.240 N PRDM8 n/a
6 TRCN0000418861 CTCCGACCTGGTGTACCATAT pLKO_005 3182 CDS 100% 10.800 7.560 N Prdm8 n/a
7 TRCN0000432415 TTGCAACATATTGATGCATTT pLKO_005 3699 3UTR 100% 10.800 7.560 N Prdm8 n/a
8 TRCN0000016761 CAGAACCTTGAAGCCTACATA pLKO.1 1569 CDS 100% 5.625 3.938 N PRDM8 n/a
9 TRCN0000016760 CCCTCTAGATCCCACAACAAA pLKO.1 1692 CDS 100% 5.625 3.938 N PRDM8 n/a
10 TRCN0000016759 CCTATATGACAGCATAGCTTT pLKO.1 1418 CDS 100% 4.950 3.465 N PRDM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.