Transcript: Human XM_011532299.1

PREDICTED: Homo sapiens RAB33B, member RAS oncogene family (RAB33B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB33B (83452)
Length:
3965
CDS:
342..1175

Additional Resources:

NCBI RefSeq record:
XM_011532299.1
NBCI Gene record:
RAB33B (83452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229748 TGACGTGCTGGTGCTAAATAA pLKO_005 1159 CDS 100% 15.000 21.000 N RAB33B n/a
2 TRCN0000229749 CCGAGTTGCTTTCTTACTAAA pLKO_005 2250 3UTR 100% 13.200 18.480 N RAB33B n/a
3 TRCN0000229746 TCCCGCATCTTCAAGATAATC pLKO_005 576 CDS 100% 13.200 18.480 N RAB33B n/a
4 TRCN0000072908 GCCGAGTTGCTTTCTTACTAA pLKO.1 2249 3UTR 100% 5.625 7.875 N RAB33B n/a
5 TRCN0000072912 CCTACCATCTTGGATAGAAGA pLKO.1 857 CDS 100% 4.950 6.930 N RAB33B n/a
6 TRCN0000218657 ACATTTGCTAGCCAATGATAT pLKO_005 887 CDS 100% 13.200 10.560 N RAB33B n/a
7 TRCN0000229747 TGACCATGTGGAAGCTATATT pLKO_005 1040 CDS 100% 15.000 10.500 N RAB33B n/a
8 TRCN0000072910 CCACGGATTCTTGTTGGAAAT pLKO.1 909 CDS 100% 10.800 7.560 N RAB33B n/a
9 TRCN0000072911 GCTGTTGTCTTCGTGTATGAT pLKO.1 810 CDS 100% 5.625 3.938 N RAB33B n/a
10 TRCN0000072909 GCCAATGATATACCACGGATT pLKO.1 897 CDS 100% 4.050 2.835 N RAB33B n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2209 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2046 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2209 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532299.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09097 pDONR223 100% 82.5% 82.3% None 1_144del;326G>A n/a
2 ccsbBroad304_09097 pLX_304 0% 82.5% 82.3% V5 1_144del;326G>A n/a
Download CSV