Transcript: Human XM_011532682.2

PREDICTED: Homo sapiens tet methylcytosine dioxygenase 3 (TET3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TET3 (200424)
Length:
11956
CDS:
521..5956

Additional Resources:

NCBI RefSeq record:
XM_011532682.2
NBCI Gene record:
TET3 (200424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246257 GGTCGTATAATGGCATATTAA pLKO_005 11394 3UTR 100% 15.000 21.000 N TET3 n/a
2 TRCN0000246260 GAACCTTCTCTTGCGCTATTT pLKO_005 2501 CDS 100% 13.200 18.480 N TET3 n/a
3 TRCN0000376843 GAACCTTCTCTTGCGCTATTT pLKO_005 2501 CDS 100% 13.200 18.480 N Tet3 n/a
4 TRCN0000246256 GAAAGATGAAGGTCCATATTA pLKO_005 3028 CDS 100% 15.000 12.000 N TET3 n/a
5 TRCN0000246259 GCCGAAGCTGTGTCCTCTTAT pLKO_005 1139 CDS 100% 13.200 9.240 N TET3 n/a
6 TRCN0000246258 ACTCCTACCACTCCTACTATG pLKO_005 4341 CDS 100% 10.800 7.560 N TET3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14428 pDONR223 100% 51.6% 24.2% None (many diffs) n/a
2 ccsbBroad304_14428 pLX_304 0% 51.6% 24.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV