Transcript: Human XM_011532694.2

PREDICTED: Homo sapiens transmembrane protein 17 (TMEM17), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM17 (200728)
Length:
1572
CDS:
341..772

Additional Resources:

NCBI RefSeq record:
XM_011532694.2
NBCI Gene record:
TMEM17 (200728)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422732 GGCACTGCAGATGTCACTTTA pLKO_005 463 CDS 100% 13.200 9.240 N TMEM17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09807 pDONR223 100% 58.9% 49.7% None (many diffs) n/a
2 ccsbBroad304_09807 pLX_304 0% 58.9% 49.7% V5 (many diffs) n/a
3 TRCN0000468554 CGTAGTACTGGTTAACAACTGCGG pLX_317 78.6% 58.9% 49.7% V5 (many diffs) n/a
Download CSV