Transcript: Human XM_011532958.2

PREDICTED: Homo sapiens tetratricopeptide repeat domain 27 (TTC27), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTC27 (55622)
Length:
2804
CDS:
259..2691

Additional Resources:

NCBI RefSeq record:
XM_011532958.2
NBCI Gene record:
TTC27 (55622)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144630 GCTGAAGAGATCGCTATTATT pLKO.1 1279 CDS 100% 15.000 21.000 N TTC27 n/a
2 TRCN0000141921 CGGTTCAGAGAGTGGATCTTT pLKO.1 339 CDS 100% 5.625 4.500 N TTC27 n/a
3 TRCN0000140963 CCCACTCCTCAGGAACATTTA pLKO.1 1171 CDS 100% 13.200 9.240 N TTC27 n/a
4 TRCN0000144039 CGGAAAGACAACAGTTGATAT pLKO.1 518 CDS 100% 13.200 9.240 N TTC27 n/a
5 TRCN0000121614 GCAGACCAATTTGAAGATAAA pLKO.1 1498 CDS 100% 13.200 9.240 N TTC27 n/a
6 TRCN0000145581 CCAATTGTTGGGAGAAAGATA pLKO.1 2399 CDS 100% 5.625 3.938 N TTC27 n/a
7 TRCN0000141464 CCAAGACCTAAGCAACCAGTT pLKO.1 2655 CDS 100% 4.050 2.835 N TTC27 n/a
8 TRCN0000142287 GCAGGTAGTAACATTCCTGGA pLKO.1 474 CDS 100% 2.160 1.512 N TTC27 n/a
9 TRCN0000122632 GCTGGAAGCAGATTCTGGAAA pLKO.1 2696 3UTR 100% 4.950 2.970 N TTC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08554 pDONR223 100% 96% 96% None 114A>G;1620C>T;1680_1681ins99 n/a
2 ccsbBroad304_08554 pLX_304 0% 96% 96% V5 114A>G;1620C>T;1680_1681ins99 n/a
Download CSV