Transcript: Human XM_011533337.1

PREDICTED: Homo sapiens collagen type VII alpha 1 chain (COL7A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL7A1 (1294)
Length:
9204
CDS:
37..8871

Additional Resources:

NCBI RefSeq record:
XM_011533337.1
NBCI Gene record:
COL7A1 (1294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272515 CCCTTGAGAGGTGACATATTC pLKO_005 3538 CDS 100% 13.200 18.480 N COL7A1 n/a
2 TRCN0000272582 TGCGTGTGCACGTCCGTTATT pLKO_005 8978 3UTR 100% 13.200 18.480 N COL7A1 n/a
3 TRCN0000320581 GAGCCAGTGGATTTCGGATTA pLKO_005 1904 CDS 100% 10.800 15.120 N COL7A1 n/a
4 TRCN0000010799 GCTCGCACTGACGCTTCTGTT pLKO.1 1267 CDS 100% 1.650 2.310 N COL7A1 n/a
5 TRCN0000272517 GCTCGCACTGACGCTTCTGTT pLKO_005 1267 CDS 100% 1.650 2.310 N COL7A1 n/a
6 TRCN0000272516 GTGACCGTGAGCACCCTATTT pLKO_005 1213 CDS 100% 13.200 9.240 N COL7A1 n/a
7 TRCN0000003568 GCACCAGATACTCCCAGGAAA pLKO.1 2490 CDS 100% 4.950 3.465 N COL7A1 n/a
8 TRCN0000003571 CAGACAGCATTCGACTTGGAT pLKO.1 1705 CDS 100% 3.000 2.100 N COL7A1 n/a
9 TRCN0000003569 TGACCCAAGCCTGTGATGACA pLKO.1 9140 3UTR 100% 3.000 2.100 N COL7A1 n/a
10 TRCN0000003570 GTGATGGTTCTGCTAGTGGAT pLKO.1 3514 CDS 100% 2.640 1.584 N COL7A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.